In the field of molecular biology and biotechnology, the efficiency of protein secretion remains a cornerstone for successful research. Among the various tools available to researchers, the human IL 2 signal peptide sequence stands out as a highly effective element for facilitating the extracellular transport of recombinant proteins. My experience with this sequence has highlighted its versatility in various expression systems, making it a staple for those working with recombinant human Interleukin-2 (IL-2) and related chimeric constructs.
The Role of the Signal Peptide in Protein Secretion
A signal peptide acts as a molecular "zip code," directing nascent polypeptides to the secretory pathway. The human IL 2 protein is naturally synthesized as a precursor containing a 20-amino acid hydrophobic leader sequence. During translocation into the endoplasmic reticulum, this signal sequence is cleaved IL2 peptide :: Interleukin 2, aa44-56 Peptide , allowing the mature protein to be secreted.
When researchers construct expression vectors, such as the pCDNA3 IL-2 signal mFc plasmid, they often incorporate this specific N-terminal sequence. By fusing the IL-2 signal peptide to a gene of interest, one can significantly improve the secretion yield of the target protein. This is a common strategy IL-2 | Recombinant Proteins in Interleukin-2 (IL-2) studies, where optimizing the amino acid sequence is vital for achieving high-level production.
Technical Specifications and Sequence Data
The genetic code for the IL-2 signal peptide is frequently represented by the DNA sequence: `ATGTACAGGATGCAACTCCTGTCTTGCATTGCACTAAGTCTTGCACTTGTCACGAATTCG`. This 60-bp sequence is highly conserved and widely utilized in IL2 research.
When analyzing human IL2 protein sequence data, it is important to note that the mature IL-2 typically begins at amino acid 21 (Ala21) and ends at Thr153. Many commercial providers offer recombinant human IL-2 (hIL-2) Ala21-Thr153 to ensure that the protein is in its active, mature form for downstream signaling experiments. The IL2_HUMAN entry in databases like UniProt provides the foundational reference for these constructs, confirming the importance of the 2 signal peptide in maintai IL-2IS stands forinterleukin 2"ImprovedSequence", also termed aldesleukin, and is a variant ofIL-2with a serine substitution for the native cysteine at Read more ning proper folding and transport.
Practical Considerations for Researchers
When I integrate this sequence into my own laboratory protocols, I focus on several key factors:
1. Expression Host: Whether using *E. coli* or mammalian cells like HEK293, the human IL signal sequence must be compatible with the host's machinery. While the native human signal peptide is highly efficient in mammalian systems, some recombinant human Interleukin-2/IL-2 prote Alteration in the IL-2 signal peptide affects secretion - PubMed in variants are expressed in *E. coli* using modified leaders to optimize yield.
2. Sequence Integrity: Always verify the amino acid alignment. Even minor variations in the sequences can affect the efficiency of protein translocation.
3. Experimental Design: When using peptides or suggested antigen peptide sequences for IL2 gene, ensure that the IL-2 signaling pathways you are investigating are not disrupted by the presence of the tag.
Insights into IL-2 Function and Structure
The study of Interleukin-2 (IL-2), a critical cytokine, extends far beyond its secretion. As an Interleukin-2 (IL-2) The small molecule binds to the same site that binds theIL-2alpha receptor and buries into a groove not seen in the free structure ofIL-2.Read more molecule, it functions through a complex signaling cascade involving JAK1 and JAK3 phosphorylation. Understanding the structure of the human Interleukin-2 protein—often analyzed via its amino acid sequence—provides deeper insights into how the mature molecule interacts with its receptors.
Whet Overview of interleukin-2 function, production and clinical her you are working with human IL-2 for structural analysis or utilizing it as a tool for protein secretion, the IL-2 signal peptide rem TheIL2gene is mapped tohumanchromosome 4q27.IL-2is originally called as T cell growth factor. Application.Interleukin-2 humanhas been used to culture Read more ains an indispensable asset. Its ability to navigate the 2 Signaling pathway effectively makes it a reliable choice for any project requiring high-quality, secreted protein products. By adhering to the established human IL sequence protocols, researchers can ensure consistent results across various high-throughput applications.