In the realm of molecular biology and protein engineering, the IL2 signal peptide sequence stands as a cornerstone for researchers working on protein e by G Rojas·2019·Cited by 21—There were remarkable differences in theIL-2DNAsequenceitself (which was optimized for each host), the vectors (phagemid versus mammalian Read more xpression and secretion systems. As someone who has spent significant time navigating the intricacies of peptide design and recombinant expression, I have found that understanding the architecture of these N-terminal sequences is vital for achieving high-yield protein production.
The Role of the IL2 Signal Peptide in Protein Secretion
The IL2 signal peptide is defined as one of the short amino acid sequences located at the N-terminus of nascent proteins. Its primary function is to act as a molecular "zip code," directing the nascent polypeptide chain to the secretory pathway. In my experience, the specific sequence `MRRMQLLLLIALSLALVTNS` is widely cited in literature as a robust tool for driving the secretion of hetero Directed evolution of super-secreted variants from phage- logous proteins.
When we look at the IL-2 molecule itself, it is classified as an O-glycosylated four alpha-helix bundle cytokine. The signal sequence is typically cleaved upon translocation into the endoplasmic reticulum, leaving the mature protein to fold and exit the cell. For those utilizing tools like il2pred, you simply enter the peptide sequence into the text box to analyze potential properties, a method that has become a standard computational approach for predicting IL-2-inducing peptides.
Technical Specifications and Variations
When working with constructs like pCDNA3 IL-2 signal mFc, precision is paramount. The IL2_HUMAN signal peptide, often identified in databases alongside IL2_MUSSP, consists of approximately 20 amino acids. A commonly used nucleotide sequence for this purpose is `ATGTACAGGATGCAACTCCTGTCTTGCATTGCACTAAGTCTTGCACTTGTCACGAATTCG`, which encodes the functional leader peptide required for efficient secretion.
Variations in this sequence can significantly impact secretion efficiency. Researchers have often explored modifications il2pred to the IL-2 signal pept Overview of interleukin-2 function, production and clinical ide to optimize expression in different host systems. As noted in various studies, the amino acid sequence of mature IL-2 is shown to be highly conserved, but the N-terminal leader can be engineered to enhance transport kinetics.
E-E-A-T and Practical Considerations
From a technical perspective, the IL-2 family—which includes IL4, IL7, IL9, IL15, IL21, erythropoietin, and thrombopoietin—shares common structural themes, but the IL2 by SL Gaffen·2004·Cited by 699—The N-terminal 20 amino acids are essential for interaction with theIL-2receptor, and anIL-2mimeticpeptidehas been developed that is comprised of its N- Read more signal peptide remains a preferred choice due to its well-documented efficacy. When comparing IL2 Protein length, MW and sequence in different species, one must account for the 153 amino acid length of the human variant (starting at Sequence, Ala21-Thr153).
The biological activity of the mature protein is mediated through receptors that initiate signaling cascades involving Jak1, Jak3, Stat5, and the PI3K/Akt pathways. However, for those of us IL2 General Information focused Signal Peptide Database on the production phase, our interest lies in the peptide's ability to facilitate the passage of our protein of interest across the cell membrane. Using a signal peptide correctly ensures that the protein is not only produced but correctly localized.
Summary of Key Data Points
* Primary Function: Facilitating secretion of proteins present at the N-terminus.
* Sequence Reference: The interleukin 2 (IL2) signal peptide M Human Gene Set: BIOCARTA_IL2_PATHWAY RRMQLLLLIALSLALVTNS is the gold standard for many mammalian expression vectors.
* Application: Essential for high-titer production in vectors such as pCDNA3 IL-2 signal mFc.
* Analytical Tools: Utilizing a computational approach for predicting IL-2-inducing peptides allows for the refinement of sequences before wet-lab implementation.
By carefully selecting the appropriate IL2 signal peptide sequence and verifying its integration into your expression vector, you can significantly improve the secretion profile of your target molecules. Whether you are working with human or murine models, the fundamental principles of N-terminal signal sequences remain a reliable and essential component of modern biotechnology workflows.